last update
2026-July-24
VirJenDB
v1.0
VirJenDB API
VirJenDB provides a public API that allows you to search virus records, retrieve genome sequences, inspect metadata fields, and download datasets programmatically.
The API is intended for:
- automated analysis workflows
- external web applications
- bioinformatics pipelines
- bulk data retrieval
- metadata exploration
The API uses JSON request bodies and standard HTTP methods.
Getting Started
The VirJenDB API base URL is:
https://api2.virjendb.org
Interactive Swagger documentation is available at:
https://api2.virjendb.org/swagger
At the time of writing, the public API does not require authentication.
Available Endpoints
| Endpoint | Method | Description |
|---|---|---|
/v2/search |
POST |
Search VirJenDB records |
/v2/download |
POST |
Download metadata, accessions, or sequences |
/v2/sequence |
POST |
Retrieve sequences using VirJenDB accession IDs |
/v2/datasets_download |
GET |
Download pre-generated datasets |
/v2/metadata |
POST |
Query metadata field definitions |
/v2/metadata_download |
POST |
Export metadata field definitions |
Searching Records
One of the main features of the VirJenDB API is the /v2/search endpoint.
It uses the same underlying search backend as the VirJenDB web interface.
Endpoint
POST /v2/search
Basic Search
This description is outdated an will be re-written, soon.
Search Response
Example responses may vary depending on the selected metadata fields and database version.
{
"total": 1244169,
"results": [
{
"source": {
"Organism Name": "Influenza A virus",
"NCBI Species": "Alphainfluenzavirus influenzae",
"Host Species": "Homo sapiens",
"Country": "China",
"Collection Date": "2017-06-30"
}
}
]
}
Search Clauses
This description is outdated an will be re-written, soon.
Search Multiple Conditions
This description is outdated an will be re-written, soon.
Search Operators
This description is outdated an will be re-written, soon.
Pagination
Search results are paginated.
| Field | Description |
|---|---|
pageSize |
Number of results returned per request |
pageNumber |
Result page number |
Example:
{
"pageSize": 100,
"pageNumber": 2
}
This returns the second page of results containing up to 100 entries. For best performance, avoid excessively large page sizes.
Note: The VirJenDB search results page can only paginate through the first 10,000 matching entries. To inspect additional matches, narrow the search query or apply filters so the relevant records fall within that range.
Sorting Results
Search results can be sorted using sortColumn and sortOrder.
Example:
{
"sortColumn": "Collection Date",
"sortOrder": "desc"
}
Supported sort directions are:
ascdesc
Example Search Request
This description is outdated an will be re-written, soon.
curl -X POST "https://api2.virjendb.org/v2/search" \
-H "Content-Type: application/json" \
-d '{
"items": [
{
"metadataField": "Host Species",
"searchTerm": "Homo sapiens"
}
],
"filter": [],
"pageSize": 20,
"pageNumber": 1,
"sortOrder": "asc"
}'
Downloading Records
The /v2/download endpoint allows you to export metadata, accession IDs, or genome sequences.
Endpoint
POST /v2/download
Information Types
The information parameter controls what type of data is downloaded.
| Type | Description |
|---|---|
metadata |
Download metadata fields |
virjendb_accessions |
Download only VirJenDB accession IDs |
sequences |
Download sequence data |
Output Formats
The fileType parameter controls the output format.
| File Type | Description |
|---|---|
csv |
Comma-separated values |
tsv |
Tab-separated values |
json |
JavaScript Object Notation |
xml |
Extensible Markup Language |
fasta |
FASTA sequence format |
FASTA output is only available when downloading sequences.
Download Scope
The scope parameter controls which records are included in the download.
| Scope | Description |
|---|---|
selection |
Download explicitly selected accession IDs |
max |
Download records matching the provided search request |
all |
Present in the API schema |
Download Matching Search Results
This description is outdated an will be re-written, soon.
The following request downloads metadata records matching a search query.
{
"download": {
"scope": "max",
"information": "metadata",
"fileType": "csv",
"metadata": [
"Organism Name",
"Host Species",
"Collection Date"
]
},
"search": {
"items": [
{
"metadataField": "Molecule Type",
"searchTerm": "ssRNA(+)"
}
],
"pageSize": 1000,
"pageNumber": 1,
"sortOrder": "asc"
}
}
This downloads metadata for all records matching the specified search query.
Download Selected Records
This description is outdated an will be re-written, soon.
Instead of downloading all matching search results, you can explicitly provide accession IDs.
Example:
{
"download": {
"scope": "selection",
"information": "metadata",
"fileType": "csv",
"selected_ids": [
"vj000000000010",
"vj000005747069"
]
}
}
VirJenDB accession IDs follow the format:
vj000000000010
Selection downloads currently support up to 10,000 accession IDs per request.
Downloading Sequences
This description is outdated an will be re-written, soon.
Sequences can be downloaded using:
{
"download": {
"scope": "selection",
"information": "sequences",
"fileType": "fasta",
"metadata": [
"Host Species",
"Molecule Type"
],
"selected_ids": [
"vj000000000010"
]
}
}
When exporting sequences in FASTA format:
- sequence data is returned in FASTA format
- metadata fields may be added to FASTA headers
- fields are separated using the
|character - the VirJenDB accession is always included in the header
Example:
>vj000000000010|Host Species=Homo sapiens|Molecule Type=ssRNA(+)
AUGCUAGCUAGCUAGCUAGC
Retrieving Sequences
The /v2/sequence endpoint retrieves sequences directly from VirJenDB accession IDs.
Endpoint
POST /v2/sequence
Example Request
{
"virjendb_accessions": [
"vj000000000010",
"vj000005747069"
]
}
Notes
- accession IDs must follow the VirJenDB accession format
- sequence formatting may vary depending on the requested records
- response structures may evolve between database versions
Downloading Precomputed Datasets
VirJenDB provides pre-generated datasets for bulk download through the /v2/datasets_download endpoint.
Endpoint
GET /v2/datasets_download
Download a Dataset
Datasets are selected using the required filename query parameter. Use one of the dataset filenames listed below.
Example:
GET /v2/datasets_download?filename=virjendbv1_full_dataset_sequence.csv.gz
Command-line examples
Metadata Datasets
curl 'https://api.virjendb.org/v2/datasets_download?filename=virjendbv1_full_dataset_metadata.csv.gz' \
-o virjendbv1_full_dataset_metadata.csv.gz
curl 'https://api.virjendb.org/v2/datasets_download?filename=virjendbv1_unique_seqs_metadata.csv.gz' \
-o virjendbv1_unique_seqs_metadata.csv.gz
curl 'https://api.virjendb.org/v2/datasets_download?filename=virjendbv1_votu_clusters_metadata.csv.gz' \
-o virjendbv1_votu_clusters_metadata.csv.gz
wget -c 'https://api.virjendb.org/v2/datasets_download?filename=virjendbv1_full_dataset_metadata.csv.gz' \
-O virjendbv1_full_dataset_metadata.csv.gz
wget -c 'https://api.virjendb.org/v2/datasets_download?filename=virjendbv1_unique_seqs_metadata.csv.gz' \
-O virjendbv1_unique_seqs_metadata.csv.gz
wget -c 'https://api.virjendb.org/v2/datasets_download?filename=virjendbv1_votu_clusters_metadata.csv.gz' \
-O virjendbv1_votu_clusters_metadata.csv.gz
Sequence Datasets
curl 'https://api.virjendb.org/v2/datasets_download?filename=virjendbv1_full_dataset_sequence.csv.gz' \
-o virjendbv1_full_dataset_sequence.csv.gz
curl 'https://api.virjendb.org/v2/datasets_download?filename=virjendbv1_unique_seqs_sequence.csv.gz' \
-o virjendbv1_unique_seqs_sequence.csv.gz
curl 'https://api.virjendb.org/v2/datasets_download?filename=virjendbv1_votu_clusters_sequence.csv.gz' \
-o virjendbv1_votu_clusters_sequence.csv.gz
wget -c 'https://api.virjendb.org/v2/datasets_download?filename=virjendbv1_full_dataset_sequence.csv.gz' \
-O virjendbv1_full_dataset_sequence.csv.gz
wget -c 'https://api.virjendb.org/v2/datasets_download?filename=virjendbv1_unique_seqs_sequence.csv.gz' \
-O virjendbv1_unique_seqs_sequence.csv.gz
wget -c 'https://api.virjendb.org/v2/datasets_download?filename=virjendbv1_votu_clusters_sequence.csv.gz' \
-O virjendbv1_votu_clusters_sequence.csv.gz
Cluster Comparison Metrics
curl 'https://api.virjendb.org/v2/datasets_download?filename=virjendbv1_votu_cluster_comparison_metrics.csv.gz' \
-o virjendbv1_votu_cluster_comparison_metrics.csv.gz
wget -c 'https://api.virjendb.org/v2/datasets_download?filename=virjendbv1_votu_cluster_comparison_metrics.csv.gz' \
-O virjendbv1_votu_cluster_comparison_metrics.csv.gz
Mapping Files
curl 'https://api.virjendb.org/v2/datasets_download?filename=ncbi_to_gtdb_map.csv.gz' \
-o ncbi_to_gtdb_map.csv.gz
wget -c 'https://api.virjendb.org/v2/datasets_download?filename=ncbi_to_gtdb_map.csv.gz' \
-O ncbi_to_gtdb_map.csv.gz
Checksum Files
SHA256 checksum files are available for downloadable datasets. They use the same /v2/datasets_download endpoint, with the checksum filename passed as the filename value.
Example:
curl 'https://api.virjendb.org/v2/datasets_download?filename=ncbi_to_gtdb_map.csv.gz' \
-o ncbi_to_gtdb_map.csv.gz
curl 'https://api.virjendb.org/v2/datasets_download?filename=ncbi_to_gtdb_map.sha256' \
-o ncbi_to_gtdb_map.sha256
Verify the downloaded file:
sha256sum ncbi_to_gtdb_map.csv.gz
cat ncbi_to_gtdb_map.sha256
Compare the SHA256 value printed by sha256sum with the expected value in the .sha256 file. If the two values match exactly, the file was downloaded successfully.
On macOS, use shasum -a 256 instead of sha256sum.
Notes
- Dataset files are gzip-compressed archives with the
.csv.gzextension. - Some sequence datasets are very large; use
wget -cfor resumable downloads. - Checksum files can be used to verify file integrity after download.
- The VirJenDB Datasets page provides dataset descriptions, version numbers, update dates, file sizes, download commands, and SHA256 values.
Query Metadata Fields
Endpoint
POST /v2/metadata
Example Request
{
"field_name": [],
"privacy": [],
"tags": [],
"submission_requiredness": [],
"submission_fieldtype": [],
"submission_validation": [],
"match_mode": "and",
"summary": false
}
Metadata Filters
| Field | Description |
|---|---|
field_name |
Filter by metadata field name |
privacy |
Filter by privacy classification |
tags |
Filter using metadata tags |
submission_requiredness |
Filter by required or optional fields |
submission_fieldtype |
Filter by field type |
submission_validation |
Filter by validation rules |
match_mode |
Combine filters using and or or |
summary |
Return summarized output |
Metadata definitions may evolve between database releases.
Export Metadata Definitions
Metadata definitions can also be downloaded directly.
Endpoint
POST /v2/metadata_download
Example Request
{
"field_name": [],
"file_type": "csv"
}
Notes
Common export formats include:
csvjsonxlsx
This endpoint can be used to export metadata field documentation and schema information.
Validation Errors
Most validation errors return HTTP status code 422.
Example:
{
"detail": [
{
"loc": ["body", "items", 0],
"msg": "field required",
"type": "value_error"
}
]
}
Additional Notes
- Very large downloads may take additional time to generate and stream data
- API response structures may evolve between database releases
- Checksum files can be used to verify dataset downloads
- The Swagger interface provides the complete OpenAPI schema